Volume 17, Issue 3 (May-Jun 2023)                   mljgoums 2023, 17(3): 32-37 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Asadpour L, Moradi Bazghaleh M. Frequency of Plasmid-Located Quinolone Resistance Genes in Clinical Isolates of Klebsiella pneumoniae in Northern Iran. mljgoums 2023; 17 (3) :32-37
URL: http://mlj.goums.ac.ir/article-1-1484-en.html
1- Department of Biology, Rasht Branch, Islamic Azad University, Rasht, Iran , l.asadpour@yahoo.com
2- PhD Student of Bacteriology, Department of Pathobiology, Faculty of Specialized Veterinary Sciences, Science and Research Branch, Islamic Azad University, Tehran, Iran
Full-Text [PDF 522 kb]   (2886 Downloads)     |   Abstract (HTML)  (14102 Views)
Full-Text:   (3275 Views)
INTRODUCTION
Klebsiella pneumoniae is an opportunistic pathogen that causes various infections such as pneumonia, septicemia, diarrhea, endophthalmitis, meningitis, bacteremia, and urinary tract infections (UTIs), which is known as the most common hospital-acquired infection (1, 2). The infections caused by drug-resistant strains of K. pneumoniae are becoming an important health problem worldwide, and in Iran, a relatively high prevalence of drug-resistant isolates of K. pneumoniae has further highlighted the importance of controlling the infections caused by this bacterium (3).
Fluoroquinolones are a class of broad-spectrum antimicrobial agents often used for the treatment of lower UTIs but are effective in treating the infections caused by K. pneumoniae and other members of Enterobacteriaceae. However, a high level of resistance to fluoroquinolones in clinical isolates of these bacteria has been reported due to chromosomal mutations in the subunits of DNA gyrase (GyrA and GyrB) and DNA topoisomerase IV (ParC and ParE) (4, 5). These mutations, which are mostly located in a region designated as the quinolone-resistance determining region in gyr and par genes, change the enzyme structure and reduce their binding to fluoroquinolones (4). As the main mechanism appears to be mutations in the chromosomally-located genes, there is reason to believe that clonal spread may be important for the dissemination of fluoroquinolones resistance (6). Other resistance mechanisms are plasmid-mediated quinolone resistance (PMQR) determinants, overexpression of efflux pumps, and alteration in membrane permeability (7). It has been demonstrated that PMQR can rapidly spread among Enterobacteriaceae and has been increasingly reported in most parts of the world (8-12).
Three mechanisms of PMQR including Qnr proteins, AAC(6')-Ib-cr enzyme, and the efflux pumps QepA and OqxAB have been described. The qnr genes, including qnrA, qnrB, qnrC, qnrD, qnrS, and qnrVC encode proteins that interact with DNA gyrase and topoisomerase IV enzymes and protect the quinolone targets. The aac(6')-Ib-cr gene encodes aminoglycoside acetyltransferase that facilitates the acetylation of aminoglycosides, ciprofloxacin, and norfloxacin. The qepAB and oqxAB genes encode quinolone efflux pumps, which confer reduced susceptibility to quinolones by drug extrusion from the cell (11, 13).
Despite the importance of plasmid-located resistance genes in the spread of resistant microorganisms, no recent research had been performed on the prevalence of PMQR genes among K. pneumonia isolates in the Guilan Province, Iran. The present study aimed to investigate fluoroquinolone resistance and the frequency of plasmid-mediated quinolone resistance genes in clinical isolates of K. pneumoniae in the Guilan Province, northern Iran.
MATERIALS AND METHODS
A total of 114 clinical isolates of K. pneumoniae were collected from patients with UTI in the Guilan Province, northern Iran. The isolates were identified through conventional microbiological methods and amplification of K. pneumoniae-specific phoE gene in a PCR reaction.
Antimicrobial susceptibility testing was performed by disc diffusion method on Mueller-Hinton agar (Merck, Germany) using levofloxacin (5 µg), norfloxacin (10 µg), ofloxacin (5 µg), and gatifloxacin (5 µg). The antibiotic disks were purchased from High Media Co., India.  In addition, the minimum inhibitory concentration (MIC) of ciprofloxacin and nalidixic acid was determined using the broth microdilution test (14).  K. pneumoniae ATCC 10031 was used as the control strain.
The isolates with quinolone MIC profiles corresponding to the presence of a possible plasmid-mediated quinolone resistance gene (i.e. ciprofloxacin MIC ≥0.06 mg/L combined with nalidixic acid MICs 4–32 mg/L) (6) were screened for qnrA, qnrB, qnrS, qepA and aac(6')-Ib-cr genes by PCR using specific primers for the corresponding genes as described previously (15). The PCR reaction solution (25 μL) contained 12.5 μL of PCR Master Mix (CinnaGen, Iran), 10 pmol of each primer, and 2.5 μL of the template DNA.  Table 1 shows the sequences of the primers used in the PCR reactions. The resulting PCR products were detected by electrophoresis on 1% agarose gel.
Table 1-The sequences of the primers used in this study
Reference Amplicon size (bp) Annealing temperature Sequences 5' to 3' Primer
This study 413 65 CGACCTACCGCAACACCGACT phoE
CGACAGCACATAGCCGAGGGAC
Al-Agamy et al.,2018 580 54 AGAGGATTTCTCACGCCAGG
TGCCAGGCACAGATCTTGAC
qnrA
Al-Agamy et al.,2018 264 54 GGMATHGAAATTCGCCACTG
TTTGCYGYYCGCCAGTCGAA
qnrB
Al-Agamy et al.,2018 428 54 GCAAGTTCATTGAACAGGGT
TCTAAACCGTCGAGTTCGGCG
qnrS
Al-Agamy et al.,2018 596 AACTGCTTGAGCCCGTAGAT
GTCTACGCCATGGACCTCAC
qepA
Al-Agamy et al.,2018 482 55 TTGCGATGCTCTATGAGTGGCTA
CTCGAATGCCTGGCGTGTTT
aac(6')-Ib-cr
RESULTS
The results of agarose gel electrophoresis of phoE gene PCR amplicons are shown in figure 1.
According to phenotypic assays, 60 isolates (52.6%) were resistant to at least two quinolone compounds, 42 isolates (36.8%) were resistant to all tested quinolones, and 28 isolates (24.6%) showed a high level of resistance to ciprofloxacin according to MIC level (>64 μg/mL). The resistance rates of K. pneumoniae isolates against the tested quinolone compounds were as follows: nalidixic acid (52.6%), ciprofloxacin (47.4%), gatifloxacin (46.5%), norfloxacin (43.9%), and levofloxacin (47.4%).
In addition, PMQR was determined in 54 (90%) quinolone-resistant K. pneumoniae isolates. Among the PMQR tested genes, aac(6')-Ib-cr was the most common PMQR gene (𝑛=44), followed by qnrS (𝑛=32), qnrB (𝑛=21), and qepA (n=3). The qnrA gene was not detected in the isolates. Moreover, 45 isolates co-harbored PMQRs. In 26 of them, the aac(6')-Ib-cr gene was associated with qnrS, and the coexistence of qnrB with aac(6')-Ib-cr and qnrS was found in 14 and 9 isolates, respectively. All qepA-positive isolates co-harbored aac(6')-Ib-cr, and the coexistence of three PMQR genes was detected in 8 isolates. On the other hand, 6 of 60 quinolone-resistant isolates in the phenotypic tests did not contain the tested PMQR genes. Agarose gel electrophoresis of aac (6')-Ib-cr, qnrB, qnrS, and qepA PCR amplicons are shown in figures 2-4.

Figure 1- Agarose gel electrophoresis of the phoE gene PCR amplicons. Lanes 1-10: 413 bp PCR amplicons; Lane M: 100 bp DNA marker.

Figure 2- Agarose gel electrophoresis of the aac (6')-Ib-cr gene PCR amplicons. Lanes 1-7: 482 bp PCR amplicons; Lane M: 100 bp DNA marker.

Figure 3- Agarose gel electrophoresis of the qnrB and qnrS genes PCR amplicons. (Left) Lanes 1-3: 264 bp PCR amplicons of qnrB; Lane M: 100bp DNA marker. (Right) Lanes 2 and 3: 428 bp PCR amplicons of qnrS; Lane M: 100 bp DNA marker

Figure 4-Agarose gel electrophoresis of the qepA gene PCR amplicons. Lanes 1-3: 596 bp PCR amplicons of qepA; Lane M: 100 bp DNA marker

DISCUSSION
Due to the widespread use of fluoroquinolones in the treatment of UTIs, resistance to this group of antibiotics has increased worldwide (16, 17). Mutations in the gyr and par genes have been reported as major mechanisms of fluoroquinolone/quinolone resistance associated with DNA gyrase and topoisomerase IV alterations in Enterobacteriaceae, as the PMQR genes and extrusion by intrinsic efflux pumps commonly mediate low-level fluoroquinolone/quinolone resistance (18).
The present study revealed quinolone resistance in more than half of clinical K. pneumonia isolates from patients with UTI. Moreover, 90% of resistant isolates harbored at least one PMQR gene. This high frequency of PMQR determinants in the present study is comparable with the results of a study carried out by Azargun et al., (2019) in Tabriz (Iran) and higher than the rate reported by studies in other parts of Iran (7, 11, 13).
 
In our study, aac(6')-Ib-cr was the predominant (73.3%) PMQR gene among quinolone-resistant K. pneumonia isolates. This finding is in agreement with the results of previous studies (11, 19, 20). Moreover, the qnrS and qnrB genes were detected in 53.3% and 35% of resistant isolates. However, qnrA was not detected in the isolates. These findings are in line with the findings of a study in Hamedan, Iran (11). In a similar research by Yugderan et al. in India, the prevalence of the aac(6')-Ib-cr gene was highest (64%) in clinical isolates of Enterobacteriaceae, and qnrA was not detected in resistant isolates (21). In a study by Badamchi et al., 58.2% of quinolone nonsusceptible uropathogenic Escherichia coli isolates harbored the PMQR-encoding genes with aac(6)-Ib-cr as the predominant gene (22).
In the present study, qepA was detected in 5% of quinolone-resistant isolates, which is similar to the rate reported by previous studies (19).
Most qnrS/qnrB-positive K. pneumoniae isolates had both aac (6')-1b-cr and qnr genes. The co-transmission of qnr with aac(6’)-Ib-cr genes that speeds up the formation of multidrug resistance in Enterobacteriaceae has been previously reported (22, 23). In the present study, 9 isolates carried two types of qnr genes. Similarly, in a study by Wang et al., qnrA, qnrB, and qnrS were detected either alone or in combination. However, some studies did not report the co-presence of different types of qnr genes (11, 24). In this study, six fluoroquinolones-resistant isolates did not harbor any of the tested genes. This indicates the possible involvement of other resistance mechanisms.
In general, the prevalence of PMQR determinants in Enterobacteriaceae may vary depending on the geographical location, study period, the pattern of antibiotic use, and the origin of bacteria.

CONCLUSION
In the present study, a high frequency and diversity of PMQR genes were detected among clinical isolates of K. pneumoniae isolates. This along with the increasing use of fluoroquinolones can lead to the emergence of highly resistant strains, which may pose a serious threat to the management of infections caused by these bacteria.

ACKNOWLEDGMENTS
The authors would like to acknowledge the support from the Islamic Azad University, Rasht Branch, Iran.

DECLARATIONS
FUNDING
The authors received no financial support for the research, authorship, and/or publication of this article.

Ethics approval and consent to participate
Not applicable since the study did not involve human or animal subjects.

CONFLICTS OF INTEREST
The authors declare that there is no conflict of interest regarding the publication of this article.
Research Article: Research Article | Subject: Microbiology
Received: 2022/02/11 | Accepted: 2022/06/6 | Published: 2023/05/21 | ePublished: 2023/05/21

References
1. Pendleton J, Gorman S, Gilmore B. Clinical relevance of the ESKAPE pathogens. Expert Rev. Anti-Infective Therapy. 2013; 11 (3): 297-308. [View at Publisher] [DOI:10.1586/eri.13.12] [PubMed] [Google Scholar]
2. Rezazadeh M, Baghchesaraei H, Peymani A. Plasmid-mediated quinolone-resistance (qnr) genes in clinical isolates of Escherichia coli collected from several hospitals of Qazvin and Zanjan Provinces, Iran. Osong public health and research perspectives. 2016;7(5):307-312. [View at Publisher] [DOI:10.1016/j.phrp.2016.08.003] [PubMed] [Google Scholar]
3. Heidary M, Nasiri MJ, Dabiri H, Tarashi S. Prevalence of drug-resistant Klebsiella pneumoniae in Iran: a review article. Iranian journal of public health. 2018; 47(3): 317-326. [View at Publisher] [PubMed] [Google Scholar]
4. Nakano R, Okamoto R, Nakano A, Nagano N, Abe M, Tansho-Nagakawa S, et al. Rapid assay for detecting gyrA and parC mutations associated with fluoroquinolone resistance in Enterobacteriaceae. Journal of microbiological methods. 2013;94(3):213-216. [View at Publisher] [DOI:10.1016/j.mimet.2013.06.019] [PubMed] [Google Scholar]
5. Rzeczkowska M, Wołkowicz T, Zacharczuk K, Gierczyński R, Semczuk K, Dzierżanowska-Fangrat K, et al. Draft genome sequence of an Escherichia coli ST410 isolate co-harbouring blaCTX-M-15, blaCMY-42, blaOXA-1, aac (3)-IIa and aac (6′)-Ib-cr genes with gyrA and parC mutations isolated from a paediatric patient in Poland. Journal of global antimicrobial resistance. 2019;16:120-122. [View at Publisher] [DOI:10.1016/j.jgar.2018.11.024] [PubMed] [Google Scholar]
6. Myrenås M, Slettemeås JS, Thorsteinsdottir TR, Bengtsson B, Börjesson S, Nilsson O, et al. Clonal spread of Escherichia coli resistant to cephalosporins and quinolones in the Nordic broiler production. Veterinary microbiology. 2018;213:123-128. [View at Publisher] [DOI:10.1016/j.vetmic.2017.11.015] [PubMed] [Google Scholar]
7. Azargun R, Barhaghi MHS, Kafil HS, Oskouee MA, Sadeghi V, Memar MY, et al. Frequency of DNA gyrase and topoisomerase IV mutations and plasmid-mediated quinolone resistance genes among Escherichia coli and Klebsiella pneumoniae isolated from urinary tract infections in Azerbaijan, Iran. Journal of Global Antimicrobial Resistance. 2019;17:39-43. [View at Publisher] [DOI:10.1016/j.jgar.2018.11.003] [PubMed] [Google Scholar]
8. Domokos J, Damjanova I, Kristof K, Ligeti B, Kocsis B, Szabo D. Multiple benefits of plasmid-mediated quinolone resistance determinants in Klebsiella pneumoniae ST11 high-risk clone and recently emerging ST307 clone. Frontiers in microbiology:2019:157. [View at Publisher] [DOI:10.3389/fmicb.2019.00157] [PubMed] [Google Scholar]
9. Jomehzadeh N, Ahmadi K, Bahmanshiri MA. Investigation of plasmid mediated quinolone resistance genes among clinical isolates of Klebsiella pneumoniae in southwest Iran. Journal of Clinical Laboratory Analysis. 2022; 36(7):e24342. [View at Publisher] [DOI:10.1002/jcla.24342] [PubMed] [Google Scholar]
10. Kareem SM, Al-Kadmy IM, Kazaal SS, Ali ANM, Aziz SN, Makharita RR, et al. Detection of gyra and parc mutations and prevalence of plasmid-mediated quinolone resistance genes in Klebsiella pneumoniae. Infection and drug resistance. 2021;14:555-563. [View at Publisher] [DOI:10.2147/IDR.S275852] [PubMed] [Google Scholar]
11. Majlesi A, Kakhki RK, Nejad ASM, Mashouf RY, Roointan A, Abazari M, et al. Detection of plasmid-mediated quinolone resistance in clinical isolates of Enterobacteriaceae strains in Hamadan, West of Iran. Saudi journal of biological sciences. 2018;25(3):426-430. [View at Publisher] [DOI:10.1016/j.sjbs.2016.11.019] [PubMed] [Google Scholar]
12. Vaziri S, Afsharian M, Mansouri F, Azizi M, Nouri F, Madadi-Goli N, et al. Frequency of qnr and aac (6') Ib-cr Genes Among ESBL-Producing Klebsiella pneumoniae Strains Isolated from Burn Patients in Kermanshah, Iran. Jundishapur journal of microbiology. 2020;13(7):1-8. [DOI:10.5812/jjm.100348] [Google Scholar]
13. Nourozi M, Mirkalantari S, Omidi S. Frequency of Plasmid-Mediated Quinolone Resistance Genes qnrA, qnrB, and qnrS among Clinical Isolates of Klebsiella pneumoniae. Journal of Applied Biotechnology Reports. 2020;7(4):203-207. [View at Publisher] [DOI] [Google Scholar]
14. CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 31st ed. CLSI supplement M100. Clinical and Laboratory Standards Institute; 2021. [View at Publisher]
15. Al-Agamy MH, Aljallal A, Radwan HH, Shibl AM. Characterization of carbapenemases, ESBLs, and plasmid-mediated quinolone determinants in carbapenem-insensitive Escherichia coli and Klebsiella pneumoniae in Riyadh hospitals. Journal of infection and public health. 2018;11(1):64-68. [View at Publisher] [DOI:10.1016/j.jiph.2017.03.010] [PubMed] [Google Scholar]
16. Flores-Mireles AL, Walker JN, Caparon M, Hultgren SJ. Urinary tract infections: epidemiology, mechanisms of infection and treatment options. Nature reviews microbiology. 2015;13(5):269-284. [View at Publisher] [DOI:10.1038/nrmicro3432] [PubMed] [Google Scholar]
17. Lorestani RC, Akya A, Elahi A. The mutations of topoisomerase genes and their effect on resistance to fluoroquinolones in extended-spectrum beta-lactamase-producing Escherichia coli. Jundishapur Journal of Natural Pharmaceutical Products. 2018;13(1): e57964. [View at Publisher] [DOI] [Google Scholar]
18. Osei Sekyere J, Amoako DG. Genomic and phenotypic characterisation of fluoroquinolone resistance mechanisms in Enterobacteriaceae in Durban, South Africa. PLoS One. 2017;12(6):e0178888. [View at Publisher] [DOI:10.1371/journal.pone.0178888] [PubMed] [Google Scholar]
19. Goudarzi M, Azad M, Seyedjavadi SS. Prevalence of plasmid-mediated quinolone resistance determinants and OqxAB efflux pumps among extended-spectrum-lactamase producing Klebsiella pneumoniae isolated from patients with nosocomial urinary tract infection in Tehran, Iran. Scientifica. 2015;2015:518167. [View at Publisher] [DOI:10.1155/2015/518167] [PubMed] [Google Scholar]
20. Mitra S, Mukherjee S, Naha S, Chattopadhyay P, Dutta S, Basu S. Evaluation of co-transfer of plasmid-mediated fluoroquinolone resistance genes and blaNDM gene in Enterobacteriaceae causing neonatal septicaemia. Antimicrobial Resistance & Infection Control. 2019; 8(1): 1-15. [View at Publisher] [DOI:10.1186/s13756-019-0477-7] [PubMed] [Google Scholar]
21. Yugendran T, Harish BN. High incidence of plasmid-mediated quinolone resistance genes among ciprofloxacin-resistant clinical isolates of Enterobacteriaceae at a tertiary care hospital in Puducherry, India. PeerJ. 2016;4:e1995. [View at Publisher] [DOI:10.7717/peerj.1995] [PubMed] [Google Scholar]
22. Badamchi A, Javadinia S, Farahani R, Solgi H, Tabatabaei A. Molecular Detection of Plasmid Mediated Quinolone Resistant Genes in Uropathogenic E. coli from Tertiary Referral Hospital in Tehran Iran. Archives of Pharmacology and Therapeutics. 2019;1(1): 19-24. [View at Publisher] [DOI:10.33696/Pharmacol.1.005] [Google Scholar]
23. Wang M, Jacoby GA, Mills DM, Hooper DC. SOS regulation of qnrB expression. Antimicrobial agents and chemotherapy. 2009;53(2):821-823. [View at Publisher] [DOI:10.1128/AAC.00132-08] [PubMed] [Google Scholar]
24. Wang A, Yang Y, Lu Q, Wang Y, Chen Y, Deng L, et al. Presence of qnr gene in Escherichia coli and Klebsiella pneumoniae resistant to ciprofloxacin isolated from pediatric patients in China. BMC Infectious Diseases. 2008;8(1):1-6. [View at Publisher] [DOI:10.1186/1471-2334-8-68] [PubMed] [Google Scholar]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.